SubtiBank SubtiBank
Version comparison:

2018-01-03 16:51:252025-05-25 06:31:09

locus

BSU18450

BSU_18450

geneLength

4560

4563

outlinks

bsu

BSU18450

BSU_18450

Gene

Coordinates

2,010,070 → 2,014,632

2,010,070 2,014,632

The protein

Catalyzed reaction/ biological activity

2 L-glutamate NADP = L-glutamine 2-oxoglutarate NADPH (according to Swiss-Prot) 2 L-glutamate NADP( ) <=> L-glutamine 2-oxoglutarate NADPH

2 L-glutamate + NADP+ --> 2-oxoglutarate + H+ + L-glutamine + NADPH (according to UniProt)

The protein

Protein family

glutamate synthase family (according to Swiss-Prot) glutamate synthase family

glutamate synthase family (with [[protein|YerD]] and [[protein|GltB]], according to UniProt)

The protein

Paralogous protein(s)

[[protein|YerD]]

[[this]]

The protein

[SW|Domains]

Glutamine amidotransferase type-2 domain (22-415)

Nucleotide binding domain (1060-1112)

[SW|Glutamine amidotransferase type-2 domain] (aa 22-415) (according to UniProt)

Nucleotide binding domain (1060-1112)

The protein

[SW|Cofactors]

[3 Fe- 4 S] cluster, FAD, FMN

Fe-S cluster [pubmed|29292548]

FAD (according to UniProt)

Biological materials

Mutant

GP807 (del ''[[gene|gltA]]-[[gene|gltB]]''::''tet'') , available in [SW|Jörg Stülke]'s lab

GP222 (''gltA'' under the control of p-xyl), available in [SW|Jörg Stülke]'s lab

1A808 ( ''gltA''::''cat''), [Pubmed|15109830], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A808&Search=1A808 BGSC]

1A809 ( ''gltA''::''kan''), [Pubmed|15109830], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A809&Search=1A809 BGSC]

BKE18450 (Δ[[gene|gltA]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATTCCTCTCCCCCGAT, downstream forward: _UP4_GTACAGTAAGGAAGGGGAGA

BKK18450 (Δ[[gene|gltA]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATTCCTCTCCCCCGAT, downstream forward: _UP4_GTACAGTAAGGAAGGGGAGA

BP123 (Δ[[gene|gltA]]-[[gene|gltB]]::''ermC'') , available in [SW|Fabian Commichau]'s lab

GP807 (Δ[[gene|gltA]]-[[gene|gltB]]::''tet'') , available in [SW|Jörg Stülke]'s lab

GP222 (''gltA'' under the control of p-xyl), available in [SW|Jörg Stülke]'s lab

1A808 ( ''gltA''::''cat''), [Pubmed|15109830], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A808&Search=1A808 BGSC]

1A809 ( ''gltA''::''kan''), [Pubmed|15109830], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A809&Search=1A809 BGSC]

BKE18450 ([[gene|gltA]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATTCCTCTCCCCCGAT, downstream forward: _UP4_GTACAGTAAGGAAGGGGAGA

BKK18450 ([[gene|gltA]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATTCCTCTCCCCCGAT, downstream forward: _UP4_GTACAGTAAGGAAGGGGAGA

Biological materials

lacZ fusion

pGP526 (in [[protein|pAC7]]), available in [SW|Jörg Stülke]'s lab [pubmed|14523131]

pGP919 (in [[protein|pAC5]]), available in [SW|Jörg Stülke]'s lab [pubmed|17183217]

pGP526 (in [SW|pAC7]), available in [SW|Jörg Stülke]'s lab [pubmed|14523131]

pGP919 (in [SW|pAC5]), available in [SW|Jörg Stülke]'s lab [pubmed|17183217]

Labs working on this gene/protein

[SW|Linc Sonenshein], Tufts University, Boston, MA, USA [http://www.tufts.edu/sackler/microbiology/faculty/sonenshein/index.html Homepage]

[SW|Jörg Stülke], University of Göttingen, Germany

[http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage]

[SW|Fabian Commichau] University of Göttingen, Germany

[http://genmibio.uni-goettingen.de/index.php?id=130 Homepage]

References

Original publications

12823818, 18199747, 11029411, 12850135, 7559360, 15150225, 2548995, 17183217, 17608797, 17134717, 14523131, 12823818, 18326565, 17981983, 18763711, 20933603, 17012385, 22389480, 22517742, 25755103, 28294562, 28386026, 29242163

12823818, 18199747, 11029411, 12850135, 7559360, 15150225, 2548995, 17183217, 17608797, 17134717, 14523131, 12823818, 18326565, 17981983, 18763711, 20933603, 17012385, 22389480, 22517742, 25755103, 28294562, 28386026, 29242163, 11967268, 31649652, 32393519

labs

[SW|Linc Sonenshein], Tufts University, Boston, MA, USA [http://www.tufts.edu/sackler/microbiology/faculty/sonenshein/index.html Homepage]

[SW|Jörg Stülke], University of Göttingen, Germany [http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage]

[SW|Fabian Commichau] Brandenburg Technical University Cottbus-Senftenberg, Germany [http://genmibio.uni-goettingen.de/index.php?id=130 Homepage]